View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_113 (Length: 240)
Name: NF7721_low_113
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_113 |
 |  |
|
| [»] chr6 (4 HSPs) |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 9825559 - 9825337
Alignment:
| Q |
18 |
ggcttatgaaggaatatggaaatagaaactcttggactaaatttgcaactgttcctcaaggttcttcttttaatcgtgaaatactttatactactgagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9825559 |
ggcttatgaaggaatatggaaatagaaactcttggactaaatttgcaactgttcctcaaggttcttcttttaatcgtgaaatactttatactactgagga |
9825460 |
T |
 |
| Q |
118 |
tgatgaagtgctgctggagattataatgcacttgtccaggtcgaggttggtggtttacgattccacaaatgatactttgaagagtcttgatattaagacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9825459 |
tgatgaagtgctgctggagattataatgcacttgtccaggtcgaagttgatggtttacgattccacaaatgatactttgaagagtcttgatattaagacc |
9825360 |
T |
 |
| Q |
218 |
aatggcaatgggaggctctcgat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9825359 |
aatggcaatgggaggctctcgat |
9825337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 9819873 - 9819816
Alignment:
| Q |
18 |
ggcttatgaaggaatatggaaatagaaactcttggactaaatttgcaactgttcctca |
75 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
9819873 |
ggcttatgaaggaatatggaaatagagactcttggactaaatttgccactgttcctca |
9819816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 158 - 215
Target Start/End: Complemental strand, 9819727 - 9819670
Alignment:
| Q |
158 |
tcgaggttggtggtttacgattccacaaatgatactttgaagagtcttgatattaaga |
215 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
9819727 |
tcgaagttgatggtttacgattccataaatgatactttgaagagtctagatattaaga |
9819670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 9703930 - 9703873
Alignment:
| Q |
18 |
ggcttatgaaggaatatggaaatagaaactcttggactaaatttgcaactgttcctca |
75 |
Q |
| |
|
|||||||||||||||||||||||||| | | |||||||||||| || ||||||||||| |
|
|
| T |
9703930 |
ggcttatgaaggaatatggaaatagagatttttggactaaattcgccactgttcctca |
9703873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 60
Target Start/End: Complemental strand, 771540 - 771501
Alignment:
| Q |
21 |
ttatgaaggaatatggaaatagaaactcttggactaaatt |
60 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
771540 |
ttatgaaggaatatggaaatacagactcttggactaaatt |
771501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 60
Target Start/End: Original strand, 2456259 - 2456298
Alignment:
| Q |
21 |
ttatgaaggaatatggaaatagaaactcttggactaaatt |
60 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
2456259 |
ttatgaaggaatatggaaataaagactcttggactaaatt |
2456298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 4142178 - 4142136
Alignment:
| Q |
18 |
ggcttatgaaggaatatggaaatagaaactcttggactaaatt |
60 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
4142178 |
ggcttatgaaggaatatggaaataaagagtcttggactaaatt |
4142136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 4157988 - 4157946
Alignment:
| Q |
18 |
ggcttatgaaggaatatggaaatagaaactcttggactaaatt |
60 |
Q |
| |
|
|||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
4157988 |
ggcttatgaaggaatatggaaataaagagtcttggactaaatt |
4157946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 32373 - 32331
Alignment:
| Q |
18 |
ggcttatgaaggaatatggaaatagaaactcttggactaaatt |
60 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
32373 |
ggcttatgaaggaatatggaaataaagactcttggattaaatt |
32331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University