View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_118 (Length: 236)
Name: NF7721_low_118
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_118 |
 |  |
|
| [»] scaffold0318 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0318 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 109 - 211
Target Start/End: Original strand, 8870 - 8972
Alignment:
| Q |
109 |
gttgatatctgtctccaaaattctttttgcaatctacatcatctactagtatactcctagtgcatactagtagatccatgtgcatctggttgtggattat |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8870 |
gttgatatttgtctccaaaattctttttgcgatctacatgatctactagtatactcctagtgcatactagtagatccatgtgcatctggttgtgggttat |
8969 |
T |
 |
| Q |
209 |
cct |
211 |
Q |
| |
|
||| |
|
|
| T |
8970 |
cct |
8972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0318; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 8688 - 8779
Alignment:
| Q |
18 |
ataacatcatataacaaacacatgagatacacaaggaataggttaccttgacaatcgtaaagaaataattacttggcacctctataaatatg |
109 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8688 |
ataacatcatataataaacacatgagatatataaggaataggttaccttgacaatagtaaagaaataattacttggcacctctataaatatg |
8779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University