View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_122 (Length: 226)
Name: NF7721_low_122
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_122 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 210
Target Start/End: Complemental strand, 9730318 - 9730125
Alignment:
| Q |
17 |
gaagacccgaaaaagaacgagaatccactagattgttggctatttggagttaatttgaataacaaaaacaaatcttgcagtgttaattcttgtttagata |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9730318 |
gaagacccgaaaaagaacgagaatcctctagattgttggttatttggagttaatttgaataacaaaaacaaatcttgcagtgttaattcttgtttagaga |
9730219 |
T |
|
| Q |
117 |
aagaacttggatgtccaagtttaaccattgttactacaagtggtcccaaagaatctattatccttaccaccaacgcatgtgaaactgaaaaggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9730218 |
aagaacttggatgtccaagtttaaccattgttactacaagtggtcccaaagaatctattatccttaccaccaacgcatgtgaaactgaaaaggt |
9730125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University