View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7721_low_123 (Length: 226)

Name: NF7721_low_123
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7721_low_123
NF7721_low_123
[»] chr7 (1 HSPs)
chr7 (1-222)||(46333310-46333528)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 46333310 - 46333528
Alignment:
1 tccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgttctgtccgcacttggacacgtgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
46333310 tccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgttctgtccacacttggacacgtgc 46333409  T
101 tttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggaatcagaaggttttgccatttatgatgcaatgatgcagatgaaaacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||   ||    
46333410 tttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggagtcagaaggttttgccatttatgatgcaatgatgcagatgaa---aa 46333506  T
201 ctcaggtttgtttcttctcact 222  Q
    || |||||||||||||||||||    
46333507 ctgaggtttgtttcttctcact 46333528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University