View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_38 (Length: 422)
Name: NF7721_low_38
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 5 - 404
Target Start/End: Original strand, 52796019 - 52796418
Alignment:
| Q |
5 |
gtttggtggtgccaggaagcaattatataagaaggaaaggtgccctataactaaatcaatataatcattagcagacgaagtaaatatggaatattacggg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796019 |
gtttggtggtgccaggaagcaattatataagaaggaaaggtgccctataactaaatcaatataatcattagcagacgaagtaaatatggaatattacggg |
52796118 |
T |
 |
| Q |
105 |
gttgtgggtttggtactagccgttttggtatggatgtggttggcaatggtgatgaaacatataagagtgaaacttggtcatcagcttccacctggaccaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796119 |
gttgtgggtttggtactagccgttttggtatggatttggttggcaatggtgatgaaacatataagagtgaaacttggtcatcagcttccacctggaccaa |
52796218 |
T |
 |
| Q |
205 |
gatgttggccagtgattggcaacattttccagctaggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatcatgaccct |
304 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796219 |
gatgttggccagtggttggcaacattttccagctaggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatcatgaccct |
52796318 |
T |
 |
| Q |
305 |
ttggctaggttccatgtgcaccgtagttgtctcttcctgtgaagcagcccgtgacatgttcaaaaacaacgatgcggctcttgcaggaaggaaggtttat |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796319 |
ttggctaggttccatgtgcaccgtagttgtctcttcctgtgaagcagcccgtgacatgttcaaaaacaacgatgcggctcttgcaggaaggaaggtttat |
52796418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University