View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_65 (Length: 340)
Name: NF7721_low_65
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 76 - 278
Target Start/End: Original strand, 13832454 - 13832642
Alignment:
| Q |
76 |
ggatgaattcatagttggatagttttttaaaatttcaaaacataaaatactccgaaaatggcctaaattagcattggtatgcaggttccgcctacttcaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13832454 |
ggatgaattcatagttggatagttttttaaaatttcaaaacataaaatactccgaaaatggcctaaattagcattggtatgcaggttccgcctactt--- |
13832550 |
T |
 |
| Q |
176 |
ccaagtctcccctcatcacatacacgtgggcgaaaaaacaactacttacaaccagtttgtggaactttcaaatctccatccataaggctgttag-aacaa |
274 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
13832551 |
------------tcaaaacatacacgtgggcgaaaaaacaactacttacaaccagtttgtggaactttcaaatctccatccagaaggctgttagtaacaa |
13832638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University