View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_66 (Length: 340)
Name: NF7721_low_66
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 132 - 325
Target Start/End: Complemental strand, 51878306 - 51878113
Alignment:
| Q |
132 |
acctgttggctacttatagatatagagtgtacaattgaattgctcaatagccaaattactcataatgtaatcaacttatgacatggttttacttttacag |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51878306 |
acctgttggctacttatagatatagagtgtacaattgaattgctcaatagccaaattactcataatgtaatcaacttatgacatggttttacttttacag |
51878207 |
T |
|
| Q |
232 |
tttaagagaattggtgtcctataaatggagggacccgtttgtgacttttatggtcatgccaatttgatctggttaatgggaaggaagagaaagg |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51878206 |
tttaagagaattggtgtcctataaatggagggacccgtttgtgacttttatggtcatgccaatttgatctggttaatgggaaggaagagaaagg |
51878113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 51878432 - 51878374
Alignment:
| Q |
8 |
ttggtgttgcataaaattttgttaagagatt---tgaggtaaataaatcatgctcttaa |
63 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51878432 |
ttggtggtgcataaaattttgttaagagatttgatgaggtaaataaatcatgctcttaa |
51878374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University