View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_73 (Length: 315)
Name: NF7721_low_73
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 50392429 - 50392721
Alignment:
| Q |
1 |
aagcccctttaattctacagtatggaagtcaaactttttcattctcagtatgcttttatcatgtcgttgagttcatatgattgctcattatggacacact |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392429 |
aagctcctttaattctacagtatggaagtcaaactttttaattctcagtatgcttttatcatgtcgttgagttcatatgattgctcattatggacacact |
50392528 |
T |
 |
| Q |
101 |
gctcttttcatattactacttttagttttattcatgcnnnnnnngcaaccttttgtaaatgtgatgttggaggtattcctgatcatcagcagcagttgag |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50392529 |
gctcttttcatattactacttttaattttattcctgcttttat-gcaaccttttgtaaatgtgatgttggaggtattcct---catcagcagcagttgag |
50392624 |
T |
 |
| Q |
201 |
ttaataaattactaattaaattttttgtttatcaaattttgttggtttcaaacacaacttgtatccatgacaatcttgttgactaaaagatatatgt |
297 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50392625 |
ttaataaattactaattaaattttttatttatcaaattttgttggtttcaaacacaacttgtatccatgacaatcttgttgactaaaagatatatgt |
50392721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University