View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_74 (Length: 314)
Name: NF7721_low_74
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 125 - 298
Target Start/End: Complemental strand, 26733801 - 26733629
Alignment:
| Q |
125 |
cacgataaacttttctttctagataaattgtaatattgaaataaaatattcaaccacactaatgataaggatgtggataaagggcaggccactttgacgc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26733801 |
cacgataaacttttctttctagataaattgtaagattgaaataaaatattcaaccacactaatgataaggatgtggataaagggcaggccactttgacgc |
26733702 |
T |
 |
| Q |
225 |
agtttattannnnnnnnaattcatgtaaaacacacgcacacaaccaataaattaaaatatttttaaaaggaaac |
298 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26733701 |
agttt-tttttttttttaattcatgtaaaacacacgcacacaaccaataaattaaaatatttttaaaaggaaac |
26733629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 44 - 107
Target Start/End: Complemental strand, 26733855 - 26733792
Alignment:
| Q |
44 |
ggtactaaccgagaatgttattttcaacttgtatttttgtctctctctcattttcacgataaac |
107 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26733855 |
ggtactaaccaataatgatattttcaacttgtatttttctctctctctcattttcacgataaac |
26733792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University