View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_77 (Length: 307)
Name: NF7721_low_77
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 3 - 288
Target Start/End: Complemental strand, 32267621 - 32267336
Alignment:
| Q |
3 |
ccggtcatcaccaccacatatagaaccatctggctgtatacttcattattaataacctgcaaaaatagttgatgaaaaaacgttgtaaatttaattgatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267621 |
ccggtcatcaccaccacatatagaaccatctggctgtatacttcattattaataacctgcaaaaatagttgatgaaaaaacgttgtaaatttaattgatt |
32267522 |
T |
 |
| Q |
103 |
gtcatggtcacattatttaagattgtagtcaaatgcagttgattcaacctatattgcaattgcaattgttgcggttatcttgcaaaccttgatattgcaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267521 |
gtcatggtcacattatttaagattgtagtcaaatgcagttgattcaacctatattgcaattgcaattgttgcggttatcttgcaaaccttgatattgcaa |
32267422 |
T |
 |
| Q |
203 |
gaaaatactatcaaacagggtcgatacgattgcaattgtaattatgataccactgcaattgtaattatgaaaccctaaattctaaa |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267421 |
gaaaatactatcaaacagggtcgatacgattgcaattgtaattatgataccactgcaattgtaattatgaaaccctaaattctaaa |
32267336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University