View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_80 (Length: 302)
Name: NF7721_low_80
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 29103369 - 29103078
Alignment:
| Q |
1 |
ctcttctctctcgggagctggatgttggtctaaaacctccattgtctgattcagaatcatcccaatcttgaagtgatttctgtcataattcaactttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103369 |
ctcttctctctcgggagctggatgttggtctaaaacctccattgtctgattcagaatcatcccaatcttgaagtgatttctgtcataattcaactttata |
29103270 |
T |
 |
| Q |
101 |
agattgataaagatatcatcatgtaatatatattacataattgatgatgttgcttacctctctaatctcattgaaactcactgcatagaaggtcactact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103269 |
agattgataaagatatcatcatgtaatatatattacataattgatgatgttgcttacctctctaatctcattgaaactcactgcatagaaggtcactact |
29103170 |
T |
 |
| Q |
201 |
gcagctgcaacaatgcccaaaactggaagagcgaattgcattgcatccatttctgatgatatatctctctcactttttgtgtttcttcttct |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103169 |
gcagctgcaacaatgcccaaaactggaagagcgaattgcattgcatccatttctgatgatatatctctctcactttttgtgtttcttcttct |
29103078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University