View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_85 (Length: 295)
Name: NF7721_low_85
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_85 |
 |  |
|
| [»] scaffold0086 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 52; Significance: 8e-21; HSPs: 3)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 22250 - 22305
Alignment:
| Q |
1 |
tgcttcttaatttatctcgaactaatgtgtaatatgcatatcattttcttcaaata |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22250 |
tgcttcttaatttatctcgaactaatgtgtaatgtgcatatcattttcttcaaata |
22305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 81 - 129
Target Start/End: Original strand, 22301 - 22349
Alignment:
| Q |
81 |
aaataaagggattataacttctttatttccttttcattttgttagtgaa |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22301 |
aaataaagggattataacttctttttttccttttcattttgttagtgaa |
22349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 220 - 256
Target Start/End: Original strand, 22947 - 22983
Alignment:
| Q |
220 |
agataaaatattgtccaattgatattttaattatatt |
256 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22947 |
agataaaatattgtccaattgacattttaattatatt |
22983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University