View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_90 (Length: 274)
Name: NF7721_low_90
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_90 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 7927913 - 7928168
Alignment:
| Q |
1 |
tagtgagagatgcatagtgattttggtgaggagaatcgcagtcagagcttcaccgaggatagaatcgtagttgcatgtgacataattgatacctgtcgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
7927913 |
tagtgagagatgcatagtgattttggtgaggagaatcgcagtgagagcttcaccgaggatagaatcgtagtcgcatgtgacagaattgatacctgtcgac |
7928012 |
T |
 |
| Q |
101 |
gaatcagtgtcgagaacataagtttttgcgacagtgaaggtagacactagaaaattggtgagaaaaatcgtagtaaaagctataccgagtgtaaaaccgt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7928013 |
gaatcagtgtcgagaacagaagtttttgcgacagtgaaggtagacaatagaaaattggtgagaaaaatcgtagtaaaagctacaccgagtgtaaaaccgt |
7928112 |
T |
 |
| Q |
201 |
agtcacctgtaacaaaattgattgtcaaaccgactctgagaagagaagcttcgtag |
256 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
7928113 |
agtcacctgtaacaaaattgattgtcgaaccggctctgagaagagaagcttcgtag |
7928168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University