View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_92 (Length: 266)
Name: NF7721_low_92
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_92 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 29274837 - 29275081
Alignment:
| Q |
1 |
tgttggtggagaagccggcagcacttgatgtggcagagcttgatttgatcttagaagcttgtgaagccaatggcgtgcagtttatggatggttgtatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274837 |
tgttggtggagaagccggcagcacttgatgtggcagagcttgatttgatcttagaagcttgtgaggccaatggcgtgcagtttatggatggttgtatgtg |
29274936 |
T |
|
| Q |
101 |
gttgcatcaccctaggacttcgaacatggaacacttgcttgatctttctaattctgatggtattggacccgttcaatttgtaagtatcttatatattttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274937 |
gttgcatcaccctaggacttcgaacatgaaacacttgcttgatctttctaattccgatggtattggacccgttcaatttgtaagtatcttatatattttt |
29275036 |
T |
|
| Q |
201 |
taaagaaaaaacgcttcattctttttataagggctatttcatttt |
245 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
29275037 |
taaagaaaaaactcttaattctttttataagggctatttcatttt |
29275081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 54 - 115
Target Start/End: Original strand, 24579139 - 24579200
Alignment:
| Q |
54 |
gaagcttgtgaagccaatggcgtgcagtttatggatggttgtatgtggttgcatcaccctag |
115 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24579139 |
gaagcttgtgagactaatggagtgcagtttatggatggttcaatgtggttgcatcaccctag |
24579200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University