View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7721_low_94 (Length: 264)
Name: NF7721_low_94
Description: NF7721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7721_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 33119974 - 33119722
Alignment:
| Q |
1 |
aactattgccaaccatcctattttgcttggacatccttgtgtgtaccaatccctatgctgtgattcgcaacgctccttagacgcgtcatcttggattaag |
100 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||| || || |||||| |||| ||||||||||| ||||| |||||||||||| |
|
|
| T |
33119974 |
aactatcgccaaccatcctatattgcttggacatccttgtgtgtaccaatctctgtgttgtgatgcgcagcgctccttagatgcgtcgtcttggattaag |
33119875 |
T |
 |
| Q |
101 |
catgcccctggttttagctgcaaaaccaacattcgatacaagattatgtataaaagctcttaacaacaatgaatatat--aagagcataataaatttaaa |
198 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| ||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
33119874 |
tatgcccccggttttagctgcaaacccaacatttgatacaagattatgtataagagctcttaacaacgatgaatatatacaagagcataataaatttaaa |
33119775 |
T |
 |
| Q |
199 |
ctactttgtttaccctatcggtggaagcacagaagccacaatttgattcatct |
251 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33119774 |
ctactttgtttaccttatcggtggaatcacagaagccacaatttgattcatct |
33119722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University