View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7722_low_18 (Length: 278)
Name: NF7722_low_18
Description: NF7722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7722_low_18 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 208 - 278
Target Start/End: Complemental strand, 3225908 - 3225838
Alignment:
| Q |
208 |
tgagtctcacgtttacaaattagtcattttataaataaacatccaataatataacccaacaccctaaaaaa |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3225908 |
tgagtctcacgtttacaaattagtcattttataaataaacatccaatcatataacccaacaccctaaaaaa |
3225838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 103 - 181
Target Start/End: Complemental strand, 3226069 - 3225991
Alignment:
| Q |
103 |
ttataaaattatgacaaagtaaacaatatataactatagaagggataaaagtgtaaagaagtgaaaattgtaatatctt |
181 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
3226069 |
ttataaaattacgacaaagtaaacaatatataactatagaagggataaaactgtaaataagtgaaaattgtaatatctt |
3225991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University