View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7722_low_20 (Length: 276)
Name: NF7722_low_20
Description: NF7722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7722_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 10066936 - 10067176
Alignment:
| Q |
1 |
attgggttcctttaggctatttaattcaattgcatgcttgtataattgtattagattaattcgttaagtttannnnnnnnctttaaaaaaggctatttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10066936 |
attgggttcctttaggctatttaattcaattgcatgcttgtataattgtattagattaattcgttaagtttattttttttctttaaaaaaggctatttaa |
10067035 |
T |
 |
| Q |
101 |
caatcataatgtatacctctnnnnnnnnncataatgtatatattgttggcc--tttttttatcatttttttcatgnnnnnnnnnnnnnngcaattacgag |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||| |
|
|
| T |
10067036 |
caatcataatgtatacctctaaaaaaaaacataatgtatatattgttggcctttttttttatcatttttttcatg-aaaaaaaaaaaaagcacttacgag |
10067134 |
T |
 |
| Q |
199 |
attgttatgggtcggaccaagattctcttatttggaaaatat |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10067135 |
attgttatgggtcggaccaatattctcttatttggaaaatat |
10067176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University