View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_high_16 (Length: 279)
Name: NF7723_high_16
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 15 - 265
Target Start/End: Complemental strand, 29654987 - 29654737
Alignment:
| Q |
15 |
aacatgaacgggaaattagtttttcacagagaagaagataaactgttaagcaagagaagataaacgaaattgcgattggtgaagaagaacgaaagaaaac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
29654987 |
aacatgaacgggaaattagtttttcacagagaaaaagataaactgttaagcaagagaagataaaggaaattgcgattggagaagaagaacgaaagaaaac |
29654888 |
T |
 |
| Q |
115 |
ttacctcagagagagtgttgagtagagaatggagtgacgaagtttgaagcttttttattttatagagcagtgttttggggtgtgaaggataagaccgtgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
29654887 |
ttacctcagagagagtgttgagtagagaatggagtgacgaagtttgaagcttttttattttatatagtagtgttttggggtgtgaaggataagaccgtgc |
29654788 |
T |
 |
| Q |
215 |
gctacgggtgtgtaatttagcacgtaatgatgattttatatagctgcgtgt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29654787 |
gctacgggtgtgtaatttagcacgtaatgatgattttatatagcagcgtgt |
29654737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University