View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7723_high_25 (Length: 219)

Name: NF7723_high_25
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7723_high_25
NF7723_high_25
[»] chr1 (1 HSPs)
chr1 (1-213)||(46008566-46008778)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 46008778 - 46008566
Alignment:
1 attttggtctcttggagtagttgttggtgaatgtttatggttgttatcattgaatctgctgagtcttggggaatgagatgtgtttgttgagggtactttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46008778 attttggtctcttggagtagttgttggtgaatgtttatggttgttatcattgaatctgctgagtcttggggaatgagatgtgtttgttgagggtactttt 46008679  T
101 ccttggtttgattcatctaatggtttaagagctttcttgaatttgatttgagcaacaaaatcttctttcgctttttcttgttctctgtttttcactgtgt 200  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
46008678 ccttgatttgattcatctaatggtttaagagctttcttgaatttgatttgagcaacaaaatcttctttcactttttcttgttctctgtttttcactgtgt 46008579  T
201 tggtgatgtccat 213  Q
    |||||||||||||    
46008578 tggtgatgtccat 46008566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University