View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_low_21 (Length: 463)
Name: NF7723_low_21
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 40491193 - 40491435
Alignment:
| Q |
19 |
gtccaatcatcaggtcaaaggtagtggttgttaattgtctgtcctcttttctttcatgtcttcacacctatatttattgttttataaatttataatttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
40491193 |
gtccaatcatcaggtcaaaggtagtggttgttaattgtctgtcctcttttctttcatgtcttca----tatattatttgttttataaatttataatttta |
40491288 |
T |
|
| Q |
119 |
aacttttctcttctattgaaataaattaagaatcaatatagtcgtatgtaatattgaaatgacaaccaacaaagaatttggttaagctgtacgggatttg |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40491289 |
accttttctcttctattgaaataaattaagaatcaatatagtcgtatgtaatattgaaatgacaaccaacaaagaatttgcttaagctgtacgggatttg |
40491388 |
T |
|
| Q |
219 |
tattttttaaatatgtcgtaaagatttgattttcgacttatgcgtat |
265 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40491389 |
gatttcttaaatatgttgtaaagatttgattttcgacttatgcgtat |
40491435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University