View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7723_low_54 (Length: 273)

Name: NF7723_low_54
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7723_low_54
NF7723_low_54
[»] chr4 (1 HSPs)
chr4 (1-262)||(28161516-28161777)


Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 28161777 - 28161516
Alignment:
1 tgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctatagaaaaaagaagtggcacttggttcctccattgtgtcggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28161777 tgtatacatcggcaggttgagtttgtggccgttgaaaactgcggcactcgggtgctctatagaaaaaagaagtggcacttggttcctccattgtgtcggg 28161678  T
101 attaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttccgtgagccatgccgggg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
28161677 attaaggaacacagtgagaccataatcagtgagacaggactcaaagtcggcaccaagtaacacattggaagatttcagatttccatgagccatgccgggg 28161578  T
201 ttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtcca 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28161577 ttttggtggatatagagaaggcctgttgctagatcttctgcaattttaagacatgatgtcca 28161516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University