View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_low_56 (Length: 268)
Name: NF7723_low_56
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 119 - 246
Target Start/End: Original strand, 33422501 - 33422629
Alignment:
| Q |
119 |
catcaagttctcaatcaaaattgtgaaatgcaaa-tttgaaaaaggaataaccagaaagaattatactatatcagcataaaaaacagaattgaatgagat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33422501 |
catcaagttctcaatcaaaattgtgaaatgcaaaatttgaaaaaggaataaccagaaagaataatactatatcagcataaaaaacagaattgaatgagat |
33422600 |
T |
|
| Q |
218 |
gatggttgactgagactgagagacacatg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33422601 |
gatggttgactgagactgagagacacatg |
33422629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 33422398 - 33422448
Alignment:
| Q |
16 |
agacaaatggaaaagagcagattagccaaagagttaatattttgatggttg |
66 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33422398 |
agacaaatggacaagagcagattagccaaagagttaatattttgatggttg |
33422448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University