View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_low_57 (Length: 253)
Name: NF7723_low_57
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_low_57 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 28249817 - 28250062
Alignment:
| Q |
8 |
tgagatggacatcaacggcgcggtaaagatcatcgtcgattttacgcgcgtgtttaggaataagaacagcgattccgttgaattttgagatgctgagttc |
107 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249817 |
tgagatagatatcaacggcgcggtaaagatcatcgtcgattttacgcgcgtgtttaggaataagaacagcgattccgttgaattttgagatgctgagttc |
28249916 |
T |
|
| Q |
108 |
accgtacgcggcgatttcagcgaggtacatatcgacggttttcgccacacgcagcatagggacggagaatgattgtttgagttctcccggtgtgaaaacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249917 |
accgtacgcggcgatttcagcgaggtacatgtcgacggttttcgccacacgcagcatagggacggagaatgattgtttgagttctcccggtgtgaaaacc |
28250016 |
T |
|
| Q |
208 |
gctgtgnnnnnnnnnnnnncaacgaagactgagatgattctgcgaa |
253 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
28250017 |
gctgtgtttttttctttttcaacgaagactgagatgattctgcgaa |
28250062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University