View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_low_60 (Length: 247)
Name: NF7723_low_60
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_low_60 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 141 - 247
Target Start/End: Original strand, 15112857 - 15112963
Alignment:
| Q |
141 |
atatgagaatagtgtagttacttcgttcatctaataataactattagtaataagataaacaatagcatttcagtacgattacaacgactcaagctaaggt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||| |||||||| |||||||||||| | |
|
|
| T |
15112857 |
atatgagaatagtgtagttacttcgttcatctaataataaatagtagtaataagataaacgatagcatttcagtatgattacaatgactcaagctaactt |
15112956 |
T |
 |
| Q |
241 |
ttactat |
247 |
Q |
| |
|
||||||| |
|
|
| T |
15112957 |
ttactat |
15112963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University