View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_low_69 (Length: 222)
Name: NF7723_low_69
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_low_69 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 20108765 - 20108556
Alignment:
| Q |
1 |
agttcatgtccaaaatagatacaccaaagtttaaattgagattgcagttgtagggaggttgcagtcacagcgattgctgagatgtttattgcgaccgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20108765 |
agttcatgtccaaaatagatacaccaaagtttaaattgggattgcagttgtaggaaggttgcagtcacagcggttgctgagatgtttattgcgaccgctg |
20108666 |
T |
|
| Q |
101 |
ttacaatagcctttattgagttttagattctggaatgtatcttttgtagcataggtacatgcttatatttttctcaactaaccctagttatttaactctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20108665 |
ttacaatagcctttattgagttttagattctggaatgtgtcttttgcagcataggtacatgcttatatttttctcaactaaccctagttatttaactctt |
20108566 |
T |
|
| Q |
201 |
ctttgatgtc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
20108565 |
ctttgatgtc |
20108556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University