View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_low_70 (Length: 219)
Name: NF7723_low_70
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 46008778 - 46008566
Alignment:
| Q |
1 |
attttggtctcttggagtagttgttggtgaatgtttatggttgttatcattgaatctgctgagtcttggggaatgagatgtgtttgttgagggtactttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46008778 |
attttggtctcttggagtagttgttggtgaatgtttatggttgttatcattgaatctgctgagtcttggggaatgagatgtgtttgttgagggtactttt |
46008679 |
T |
|
| Q |
101 |
ccttggtttgattcatctaatggtttaagagctttcttgaatttgatttgagcaacaaaatcttctttcgctttttcttgttctctgtttttcactgtgt |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46008678 |
ccttgatttgattcatctaatggtttaagagctttcttgaatttgatttgagcaacaaaatcttctttcactttttcttgttctctgtttttcactgtgt |
46008579 |
T |
|
| Q |
201 |
tggtgatgtccat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46008578 |
tggtgatgtccat |
46008566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University