View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7723_low_71 (Length: 212)
Name: NF7723_low_71
Description: NF7723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7723_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 14 - 177
Target Start/End: Complemental strand, 27034684 - 27034522
Alignment:
| Q |
14 |
cctgtgtctgtgcttcatagtaaatttggcaggaagtaaaagacagtaacatgaaaaaacaatgtagcatgaatgtaatacnnnnnnncgatgccattga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27034684 |
cctgtgtctgtgcttcatagtaaatttggcaggaagtaaaagacagtaacatgaaaaaacaatgtagcatgaatgtaatactttttttcgatgccattga |
27034585 |
T |
|
| Q |
114 |
acctatcaaatttcagattcnnnnnnnctaaaccgaaacaaattgtattcatgaatgtaatacc |
177 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27034584 |
acctatcaaatttcagattc-ttttttctaaaccgaaacaaattgtattcatgaatgtaatacc |
27034522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University