View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7725_high_7 (Length: 293)
Name: NF7725_high_7
Description: NF7725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7725_high_7 |
 | |
|
| [»] scaffold0831 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0831 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: scaffold0831
Description:
Target: scaffold0831; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 277
Target Start/End: Original strand, 4882 - 5143
Alignment:
| Q |
16 |
ataatctataccaggccagttcttcataatattaccatgtgaatcaagaactgtgtatccattgatgtagtggcattttatcttgctagagacaaagtta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4882 |
ataatctataccaggccagttcttcataatattaccatgtgaatcaagaactgtgtatccattgatgtagtggcattttatcttgctagagacaaagtta |
4981 |
T |
|
| Q |
116 |
cgagttcatgatcattcacaagtgcaatgcaacaggaaaatagagaagacgtaatgtactactactgattggaacatatatctcagaaaacatcttttca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4982 |
cgagttcatgatcattcacaagtgcaatgcaaaaggaaaatagagaagacgtaatgtactactactgattggaacatatatatcagaaaacatcttttca |
5081 |
T |
|
| Q |
216 |
atgactattttggttgtacagatgtataaacaaccatttatgtttcaacagtataaacaaat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5082 |
atgactattttggttgtacagatgtataaacaaccatttatgtttcaacagtataaacaaat |
5143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University