View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7725_high_7 (Length: 293)

Name: NF7725_high_7
Description: NF7725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7725_high_7
NF7725_high_7
[»] scaffold0831 (1 HSPs)
scaffold0831 (16-277)||(4882-5143)


Alignment Details
Target: scaffold0831 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: scaffold0831
Description:

Target: scaffold0831; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 277
Target Start/End: Original strand, 4882 - 5143
Alignment:
16 ataatctataccaggccagttcttcataatattaccatgtgaatcaagaactgtgtatccattgatgtagtggcattttatcttgctagagacaaagtta 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4882 ataatctataccaggccagttcttcataatattaccatgtgaatcaagaactgtgtatccattgatgtagtggcattttatcttgctagagacaaagtta 4981  T
116 cgagttcatgatcattcacaagtgcaatgcaacaggaaaatagagaagacgtaatgtactactactgattggaacatatatctcagaaaacatcttttca 215  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
4982 cgagttcatgatcattcacaagtgcaatgcaaaaggaaaatagagaagacgtaatgtactactactgattggaacatatatatcagaaaacatcttttca 5081  T
216 atgactattttggttgtacagatgtataaacaaccatttatgtttcaacagtataaacaaat 277  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5082 atgactattttggttgtacagatgtataaacaaccatttatgtttcaacagtataaacaaat 5143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University