View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7725_high_8 (Length: 239)
Name: NF7725_high_8
Description: NF7725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7725_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 45372481 - 45372692
Alignment:
| Q |
11 |
ggtgttggacacgttatgccgacgcatgtgattatattcaatattgttcttaaatcacatgtgccaactgaggaccactaaaaacaactcaaaaatatca |
110 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45372481 |
ggtgtcggatacgttatgccgacgcatgtgattatattcaatattgttcttaaatcacatgtgccaactgaggaccactaaaaacaactcaaaaatatca |
45372580 |
T |
|
| Q |
111 |
agtactattgttctttatctcctcacattcaatatgctcttggtggctggtgaagctttctcaagttcaaactttatcagaaccaaagtcatcaaatccc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45372581 |
agtactattgttctttatctcctcacattcaatatgctcttggtggctggtgaggctttctcaagttcaaactttatcagaaccaaagtcatcgaatccc |
45372680 |
T |
|
| Q |
211 |
aaccctacaaac |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45372681 |
aaccctacaaac |
45372692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University