View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7726_high_20 (Length: 237)
Name: NF7726_high_20
Description: NF7726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7726_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 33124376 - 33124167
Alignment:
| Q |
14 |
ataatactatttctctgcaaggtctaactgaaatttggtgtgctatttatcaatttaaggtgcctattgcaatttctgttacactttttgaagccatatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33124376 |
ataatactatttctctgcaaggtctaactgaaatttggtgtgctatttatcaatttaaggtgcctattgcaatttctgttacactttttgaagccatatg |
33124277 |
T |
 |
| Q |
114 |
cttatgcaaaggaactagagtaattgcatcaaggggaaaggaaatcacttggaagtttcataagatctgtctttactgcttctgtggaataatagctggt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33124276 |
cttatgcaaaggaactagagtaattgcatcaaggggaaaggaaatcacttggaagtttcataagatctgtctttactgcttctgtggaataatagctggt |
33124177 |
T |
 |
| Q |
214 |
atggttagtg |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
33124176 |
atggttagtg |
33124167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 7570697 - 7570782
Alignment:
| Q |
71 |
aggtgcctattgcaatttctgttacactttttgaagccatatgcttatgcaaaggaactagagtaattgcatcaaggggaaaggaa |
156 |
Q |
| |
|
|||| |||||||| || |||||||| ||||||||||| ||||| ||| ||||||||| ||||| ||| ||||| |||||||||| |
|
|
| T |
7570697 |
aggttcctattgctatctctgttacgctttttgaagctgtatgcatatacaaaggaacaagagtgattaaatcaaagggaaaggaa |
7570782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University