View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7726_high_9 (Length: 438)
Name: NF7726_high_9
Description: NF7726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7726_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 11 - 394
Target Start/End: Original strand, 35319580 - 35319963
Alignment:
| Q |
11 |
aagaatatggagtattattgaggaatgcatgagtgcggagagagaagaaaagatcttttatgggtgaattaaggataaggaaaggaggtataaaatgagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35319580 |
aagaatatggagtattattgaggaatgcatgagtgcggagagagaagaaaagatcttttatgggtgaattaaggataaggaaaggaggtataaaatgagt |
35319679 |
T |
 |
| Q |
111 |
gattcagttcgtagggaggttgagccaccaagtgctgcctatacagtctttctactcatcatccccttgaactgatcattctcttccattttacacccta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35319680 |
gattcagttcgtagggaggttgagccaccaagtgctgcctatacagtctttctactcatcatccccttgaactgatcatcctcttccattttacacccta |
35319779 |
T |
 |
| Q |
211 |
gaggtaaggggatctttattgtgaagctaataaaacattgtctaaagatataatttatcaagagctgttggcaataggtcaaatctgttgtcagtaaaga |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35319780 |
gaggtaaggggatctttattgtgaagctaataaaacattgtctaaggatataatttatcaagagctgttggcaacaggtcaaatctgttgtcagtaaaga |
35319879 |
T |
 |
| Q |
311 |
gaattcattcaatcattattacataaacattttcaatctatctgcctctttctaatatcataaaccactatacaccctttccaa |
394 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35319880 |
gaattcattcaatcattatcacataaacattttcaatctatctgcctctttctaatatcataaaccactacacaccctttccaa |
35319963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University