View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7726_low_19 (Length: 289)
Name: NF7726_low_19
Description: NF7726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7726_low_19 |
 | |
|
| [»] chr6 (5 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 268; Significance: 1e-150; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 18 - 289
Target Start/End: Original strand, 33908693 - 33908964
Alignment:
| Q |
18 |
attactgtgataggaattagggtttcagtgttacaatattagccctgaaccttaccttcttcagtgtcttgtatatatgagccatacttcaacagtatta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33908693 |
attactgtgataggaattagggtttcagtgttacaatattatccctgaaccttaccttcttcagtgtcttgtatatatgagccatacttcaacagtatta |
33908792 |
T |
|
| Q |
118 |
ataatactattttcgtctaaaaaacatttgtcaggtacacttcctcctgattttggacttcactcaaagctaagaagttttcatgttacaacaaacagat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33908793 |
ataatactattttcgtctaaaaaacatttgtcaggtacacttcctcctgattttggacttcactcaaagctaagaagttttcatgttacaacaaacagat |
33908892 |
T |
|
| Q |
218 |
ttgagggaagattgccagagaatttgtgctatcatggagagttacaaaatttaactgcctatgaaaatcatc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33908893 |
ttgagggaagattgccagagaatttgtgctatcatggagagttacaaaatttaactgcctatgaaaatcatc |
33908964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 67 - 107
Target Start/End: Complemental strand, 9405166 - 9405126
Alignment:
| Q |
67 |
ccttaccttcttcagtgtcttgtatatatgagccatacttc |
107 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9405166 |
ccttgccttctttagtgtcttgtatatatgagccatacttc |
9405126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 188
Target Start/End: Original strand, 33884595 - 33884635
Alignment:
| Q |
148 |
tcaggtacacttcctcctgattttggacttcactcaaagct |
188 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
33884595 |
tcaggtacacttccttctgattttggtcttcactcaaagct |
33884635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 33896677 - 33896637
Alignment:
| Q |
148 |
tcaggtacacttcctcctgattttggacttcactcaaagct |
188 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
33896677 |
tcaggtacacttccttctgattttggtcttcactcaaagct |
33896637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 53
Target Start/End: Original strand, 9627250 - 9627282
Alignment:
| Q |
21 |
actgtgataggaattagggtttcagtgttacaa |
53 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
9627250 |
actgtgataagaattagggtttcagtgttacaa |
9627282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 66 - 111
Target Start/End: Complemental strand, 28666842 - 28666797
Alignment:
| Q |
66 |
accttaccttcttcagtgtcttgtatatatgagccatacttcaaca |
111 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28666842 |
accttgccttcttccgtgtcttgtatatatgagccatacttcaaca |
28666797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 73 - 108
Target Start/End: Original strand, 44608581 - 44608616
Alignment:
| Q |
73 |
cttcttcagtgtcttgtatatatgagccatacttca |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44608581 |
cttcttcagtgtcttctatatatgagccatacttca |
44608616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 111
Target Start/End: Original strand, 9293752 - 9293797
Alignment:
| Q |
66 |
accttaccttcttcagtgtcttgtatatatgagccatacttcaaca |
111 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
9293752 |
accttaccttcttcgatgtcttgtatacatgagccctacttcaaca |
9293797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 111
Target Start/End: Complemental strand, 34697240 - 34697195
Alignment:
| Q |
66 |
accttaccttcttcagtgtcttgtatatatgagccatacttcaaca |
111 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| | |||||||||| |
|
|
| T |
34697240 |
acctttccttcttctgtgtcttgtatatatgagtcgtacttcaaca |
34697195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University