View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_high_36 (Length: 240)
Name: NF7727_high_36
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_high_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 83 - 223
Target Start/End: Complemental strand, 7977216 - 7977076
Alignment:
| Q |
83 |
gtactacccttaccactgccacaatattgaacactcacactttatttgttattgatttcaatgagctataaccaccgtgcaattccacttcttgagtctc |
182 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7977216 |
gtactacccttaccactgccaccatattgaacactcacactttatttgtagttgatttcaatgagctataaccaccgtgcaattccacttcttgagtctc |
7977117 |
T |
 |
| Q |
183 |
aagattcgcgcaaggtatgtcttattcatttccaccttttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7977116 |
aagattcgcgcaaggtatgtcttattcatttccaccttttt |
7977076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University