View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_high_42 (Length: 219)
Name: NF7727_high_42
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 379507 - 379323
Alignment:
| Q |
19 |
acaacgactcatcatcatgacatccgtcgcctcctccgccgccacatggtgctggtggggttcaagctcattcaactaaggtggtccagatcaggggcag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
379507 |
acaacgactcatcatcatgacatccgtcgcctcctccgcctccacatggtgctggtggggttcaagctcattcaactaaggtggtccagatcaggggcaa |
379408 |
T |
 |
| Q |
119 |
atcttcttaggagtccatggtagccatggctccccctaaatatggtattaatattgtatcaatcatacttaatcaggcttttcat |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
379407 |
atcttcttaggagtccatggtaaccatggctccccccaaatatggtattaatattgtatcatgcatacttaatgaggcttttcat |
379323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 110 - 156
Target Start/End: Complemental strand, 10574361 - 10574315
Alignment:
| Q |
110 |
caggggcagatcttcttaggagtccatggtagccatggctcccccta |
156 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10574361 |
caggggcggatcttcttgggagcccatggtagccatggctcccccta |
10574315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 173
Target Start/End: Complemental strand, 42148821 - 42148764
Alignment:
| Q |
116 |
cagatcttcttaggagtccatggtagccatggctccccctaaatatggtattaatatt |
173 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| |||| | ||||| ||||| |
|
|
| T |
42148821 |
cagatcttcttaagagcccatggtagccatggctccccccaaatttcgtatttatatt |
42148764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University