View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7727_high_43 (Length: 209)

Name: NF7727_high_43
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7727_high_43
NF7727_high_43
[»] chr6 (1 HSPs)
chr6 (87-190)||(33795312-33795415)


Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 87 - 190
Target Start/End: Original strand, 33795312 - 33795415
Alignment:
87 gatgtcactttgttggccattgtcgggttatgtttacacccttttctatataaatatttgtccctgcccgtgaagggacttaatatttaatatacactat 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33795312 gatgtcactttgttggccattgtcgggttatgtttacacccttttctatataaatatttgtccctgcccgtgaagggacttaatatttaatatacactat 33795411  T
187 aggg 190  Q
    ||||    
33795412 aggg 33795415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University