View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_low_11 (Length: 519)
Name: NF7727_low_11
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 207 - 502
Target Start/End: Complemental strand, 52518952 - 52518657
Alignment:
| Q |
207 |
ctaagggctgaatatattaagttttgaatggcatcaatatcttgttttagtaagagtccattgcccatgaaagagacagctttgagccatggtgaatatc |
306 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518952 |
ctaagggctgaatatattaagttgtgaatggcatcaacatcttgttttagtaagagtccattacccatgaaagagacagctttgagccatggtgaatatc |
52518853 |
T |
|
| Q |
307 |
ctccacctatggcaacttatgaggaggttgtagacaatcccaagctcttcatactttgcttggagaagctccacactctaatgggcaccaagttcatgta |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518852 |
ctccacctatggcaacttatgaggaggttgtagacaatcccaagctcttcatactttgcttggagaagctccacactctaatgggcaccaagttcatgta |
52518753 |
T |
|
| Q |
407 |
agctccctggatttataaactacaaactagagattgtgacttggtttacttttatattaagatgtggaaaatactagcatatcatgtcaaattcct |
502 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52518752 |
agctccctggatttataaactacgaactagagattgtgacttggtttacttttatattaagatgtggaaaatactagcatatcatgtcaaattcct |
52518657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 52519140 - 52519100
Alignment:
| Q |
14 |
attattctcattaatgtttttgttttccctatctacaaata |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52519140 |
attattctcattaatgtttttgttttccctatctacaaata |
52519100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University