View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7727_low_28 (Length: 338)

Name: NF7727_low_28
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7727_low_28
NF7727_low_28
[»] chr7 (2 HSPs)
chr7 (18-169)||(31261933-31262084)
chr7 (240-322)||(31261780-31261862)


Alignment Details
Target: chr7 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 31262084 - 31261933
Alignment:
18 atggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgtta 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31262084 atggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgtta 31261985  T
118 actttcgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa 169  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||    
31261984 acttttgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa 31261933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 240 - 322
Target Start/End: Complemental strand, 31261862 - 31261780
Alignment:
240 aagtgttatgcattgtggtctgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtca 322  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31261862 aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtca 31261780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University