View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_low_28 (Length: 338)
Name: NF7727_low_28
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 18 - 169
Target Start/End: Complemental strand, 31262084 - 31261933
Alignment:
| Q |
18 |
atggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262084 |
atggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttggtattctttccatcttttgtta |
31261985 |
T |
 |
| Q |
118 |
actttcgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa |
169 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261984 |
acttttgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa |
31261933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 240 - 322
Target Start/End: Complemental strand, 31261862 - 31261780
Alignment:
| Q |
240 |
aagtgttatgcattgtggtctgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtca |
322 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261862 |
aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtca |
31261780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University