View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_low_31 (Length: 334)
Name: NF7727_low_31
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 132 - 303
Target Start/End: Complemental strand, 37963093 - 37962908
Alignment:
| Q |
132 |
agaggcgaatcgtgcaaccatgtgtcccttgcgctatttatcaa--------------tgcatcacctcaccaccatcttcacacaaatggcaaccacga |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37963093 |
agaggcgaatcgtgcaacgatgtgtcccttgcgctatttatcaaatacctcttaccactgcatcacctcaccaccatcttcacacaaatggcaaccacga |
37962994 |
T |
 |
| Q |
218 |
caacaatattcaccgctcttctctttcttttctcactcttcttcaccacaaccgtcagatccgtaagtatcaccacctctctcttc |
303 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37962993 |
caacaatattcaccgctcttatctttcttttctcactctccttcaccacaaccgtcagatccgtaagtatcaccatctctctcttc |
37962908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 132 - 176
Target Start/End: Complemental strand, 6347183 - 6347139
Alignment:
| Q |
132 |
agaggcgaatcgtgcaaccatgtgtcccttgcgctatttatcaat |
176 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6347183 |
agagtcgaatcgtgcaaccatgtgtccctcgcgctatttatcaat |
6347139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University