View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_low_42 (Length: 253)
Name: NF7727_low_42
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 31549127 - 31548894
Alignment:
| Q |
1 |
gcaggtaataaagacattctttttataaaaaggttgcatgctattggatataaaaaccactagtgttttt-gtaggatttagaaccgtaacagcttagga |
99 |
Q |
| |
|
||||||||| | ||||||||||| | ||||| ||||||||||||||||||||||||||||| |||||||| || |||| |||||| |||||||||||||| |
|
|
| T |
31549127 |
gcaggtaatgacgacattcttttgacaaaaatgttgcatgctattggatataaaaaccacttgtgttttttgttggatatagaactgtaacagcttagga |
31549028 |
T |
 |
| Q |
100 |
tagctattcaacgtatccattataacgattatcatgttgttaattgcatatgtttcttgttaggtgactgatgtatctgtattcgagacaaggacagaat |
199 |
Q |
| |
|
| | ||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31549027 |
ttgtaattcaacgtattcattattacgattatcgtgttgttaattgcatatgtttcttgttaggtgactgatgtatctgtattcgagacaaggacagaat |
31548928 |
T |
 |
| Q |
200 |
ttgaagggcaacaaaaacttgtcgacgagttgca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31548927 |
ttgaagggcaacaaaaacttgtcgacgagttgca |
31548894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University