View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_low_47 (Length: 236)
Name: NF7727_low_47
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 33490230 - 33490029
Alignment:
| Q |
13 |
gaagaatatctgacgggtagcaatttttaagcaattaataattttcttcatagccaagaagaaaattatccgagccaaagtggtttaggttttgtctttc |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33490230 |
gaagaaaatctgacgggtagcaatttttaagcaaataaca-ttttcttcatagccaagaagaaaattatccgagccaaagtggtttagattttgtctttc |
33490132 |
T |
 |
| Q |
113 |
agaatcgacatcgccaggtaataattgttcaaagggtatatgtacaaaacttaggtggga---tcatggatatcatgccaaattggaaatgtgatgattc |
209 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33490131 |
agaatcgacatcgacatgtaataattgttcaaagggtgtatgtacaaaacttaggtgggatcatcatggatatcatgccaaattggaaatgtgatgattc |
33490032 |
T |
 |
| Q |
210 |
ctc |
212 |
Q |
| |
|
||| |
|
|
| T |
33490031 |
ctc |
33490029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University