View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_low_49 (Length: 235)
Name: NF7727_low_49
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_low_49 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 552390 - 552190
Alignment:
| Q |
17 |
aatatcgaaggtccaaaataattgtagagcagtgataagataagataccatgaaaagaagacaagaaacttctgcatagagaagtagagataacaactta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
552390 |
aatatcgaaggtccaaaataattgtagagcagtgataagataagataccatgaaaaaaagacaagaaacttctgcatagagaagtagagataacaactta |
552291 |
T |
|
| Q |
117 |
attatcaatggaggtgagtctactagacggggttaacttttgcaaactaacgagcgaatcaagatttgaatccgagagataacagaccctttccttattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
552290 |
attatcaatggaggtgagtctactagaaggggttaacttttgcaaactaaggagcgaatcaagatttgaatccgagagataacagaccatttccttattt |
552191 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
552190 |
t |
552190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University