View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7727_low_54 (Length: 209)
Name: NF7727_low_54
Description: NF7727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7727_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 87 - 190
Target Start/End: Original strand, 33795312 - 33795415
Alignment:
| Q |
87 |
gatgtcactttgttggccattgtcgggttatgtttacacccttttctatataaatatttgtccctgcccgtgaagggacttaatatttaatatacactat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33795312 |
gatgtcactttgttggccattgtcgggttatgtttacacccttttctatataaatatttgtccctgcccgtgaagggacttaatatttaatatacactat |
33795411 |
T |
 |
| Q |
187 |
aggg |
190 |
Q |
| |
|
|||| |
|
|
| T |
33795412 |
aggg |
33795415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University