View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7728_low_17 (Length: 249)
Name: NF7728_low_17
Description: NF7728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7728_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 13539461 - 13539559
Alignment:
| Q |
31 |
tctatgcaaggagttgggatcctctatggtgttttgcaaaagtaacagagagcttcgttatgatagggatagacataaaaagtagaaataatgctagcag |
130 |
Q |
| |
|
||||||||||||||||| ||||||| | |||||||||||||||| || |||| ||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13539461 |
tctatgcaaggagttgg-atcctctctagtgttttgcaaaagtatcaaagagtttcattatgatagggataaacataaaaagtagaaataatgctagcag |
13539559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 13685013 - 13684915
Alignment:
| Q |
31 |
tctatgcaaggagttgggatcctctatggtgttttgcaaaagtaacagagagcttcgttatgatagggatagacataaaaagtagaaataatgctagcag |
130 |
Q |
| |
|
||||||||||||||||| ||||||| | |||||||||||||||| || |||| ||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13685013 |
tctatgcaaggagttgg-atcctctctagtgttttgcaaaagtatcaaagagtttcattatgatagggataaacataaaaagtagaaataatgctagcag |
13684915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University