View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7728_low_19 (Length: 239)
Name: NF7728_low_19
Description: NF7728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7728_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 37134715 - 37134512
Alignment:
| Q |
1 |
tatgttgaaagagtgtactataaatttcataatccattaattatatttttgccatcaataattaactatcgtgtttgccaaatgcctacaatggctagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37134715 |
tatgttgaaagagtgtactataaatttcataatccattaattatatttttgccatcaataattaactaacgtgtttgccaaatgcctacaatggctagtc |
37134616 |
T |
 |
| Q |
101 |
gtttgatctataatatagctagcaagaatccatgagtcatagcggtcaattgttttgcttacctcgttggcaacgaatgattcatatattattcatgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37134615 |
gtttgatctataatatagctagcaagaatccatgagtcatagcggttaattgttttgcttacctcgttggcaacgaatgattcatatattattcatgtta |
37134516 |
T |
 |
| Q |
201 |
cacg |
204 |
Q |
| |
|
|||| |
|
|
| T |
37134515 |
cacg |
37134512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University