View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7729_low_11 (Length: 292)

Name: NF7729_low_11
Description: NF7729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7729_low_11
NF7729_low_11
[»] chr3 (3 HSPs)
chr3 (27-277)||(17501794-17502042)
chr3 (183-277)||(1653477-1653571)
chr3 (229-275)||(20611257-20611303)
[»] chr2 (3 HSPs)
chr2 (180-277)||(31902945-31903042)
chr2 (229-282)||(39339387-39339440)
chr2 (182-273)||(2062247-2062338)
[»] chr6 (3 HSPs)
chr6 (180-282)||(12793540-12793642)
chr6 (180-275)||(16510851-16510946)
chr6 (229-276)||(9223377-9223424)
[»] chr8 (4 HSPs)
chr8 (180-275)||(34866620-34866715)
chr8 (232-277)||(10551783-10551828)
chr8 (187-275)||(34389576-34389664)
chr8 (229-277)||(9519093-9519141)
[»] chr4 (1 HSPs)
chr4 (180-275)||(30963866-30963961)
[»] chr7 (4 HSPs)
chr7 (180-282)||(37792734-37792836)
chr7 (229-275)||(38305712-38305758)
chr7 (229-277)||(47326431-47326479)
chr7 (193-257)||(38484991-38485055)
[»] chr1 (4 HSPs)
chr1 (187-275)||(41919892-41919980)
chr1 (229-282)||(4651256-4651309)
chr1 (231-261)||(17032909-17032939)
chr1 (182-255)||(19597943-19598016)
[»] chr5 (2 HSPs)
chr5 (182-255)||(27712405-27712478)
chr5 (191-255)||(39184829-39184893)


Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 27 - 277
Target Start/End: Complemental strand, 17502042 - 17501794
Alignment:
27 gttagcgctggttttagcctatgaaacgttcatcatgtttagtacaccctatgagctttcgttcatcttgtttgattcctgtatacatccataacaacaa 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||  |||||||||||||||||||||||||||||||    
17502042 gttagcgctggttttagcctatgaaacgttcatcatgtttagtacaccctatgagctttcattcatc--gtttgattcctgtatacatccataacaacaa 17501945  T
127 gaacaactacatcgtctccacaataaaaaacaatattagaacaactgcgctggtttttacgatctaggttgtgtttcagcttcaaactgacgtcattgtc 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
17501944 gaacaactacatcgtctccacaataaaaaacaatattagaacaactgcgctggtttttacgatctaggttgtgtttccgcttcaaactgacgtcattgtc 17501845  T
227 catgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgct 277  Q
    | |||||||||||| |||||||||||||||||||||||| |||||||||||    
17501844 cgtgttttgttgttagatttcgtcttcctctagatctatatttgtgttgct 17501794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 1653571 - 1653477
Alignment:
183 ttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgct 277  Q
    ||||||||| |||||| |||  ||||||||| | ||||  || || |||||||||||||||||||||||||||| | || |||||||||||||||    
1653571 ttacgatctgggttgtcttttcgcttcaaaccggcgtcgatgcccgtgttttgttgttggatttcgtcttcctccatatttatgtttgtgttgct 1653477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 20611257 - 20611303
Alignment:
229 tgttttgttgttggatttcgtcttcctctagatctatgtttgtgttg 275  Q
    ||||||||||||||||||| ||||| ||||||||||| |||||||||    
20611257 tgttttgttgttggatttcctcttcatctagatctatatttgtgttg 20611303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 180 - 277
Target Start/End: Complemental strand, 31903042 - 31902945
Alignment:
180 tttttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgct 277  Q
    |||||| ||||||||||||||||| ||||||||| | ||||  || || |||||||||||||| ||||||||||||||||||||||||| ||||||||    
31903042 tttttatgatctaggttgtgtttccgcttcaaaccggcgtcgctgcccgtgttttgttgttgggtttcgtcttcctctagatctatgttagtgttgct 31902945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 39339440 - 39339387
Alignment:
229 tgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgctctctg 282  Q
    ||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||    
39339440 tgttttgttgttggatttcctcttcctctagatctatatttgtgttgctgtctg 39339387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 182 - 273
Target Start/End: Original strand, 2062247 - 2062338
Alignment:
182 tttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgt 273  Q
    |||||||||| ||||||||||| |||||| || | ||||  || || |||||||||||||| || | |||| |||| ||||| |||||||||    
2062247 tttacgatctgggttgtgtttccgcttcagaccggcgtcgctgcccgtgttttgttgttgggttgcatctttctcttgatctgtgtttgtgt 2062338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 180 - 282
Target Start/End: Original strand, 12793540 - 12793642
Alignment:
180 tttttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgctct 279  Q
    |||||||||| | ||||||||||  ||||||||||| |||| ||| || ||||||| || |||||||||||||||||| ||||||  ||||||||||| |    
12793540 tttttacgatatgggttgtgttttcgcttcaaactggcgtcgttgcccgtgttttggtgatggatttcgtcttcctctggatctaaatttgtgttgctgt 12793639  T
280 ctg 282  Q
    |||    
12793640 ctg 12793642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 180 - 275
Target Start/End: Complemental strand, 16510946 - 16510851
Alignment:
180 tttttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttg 275  Q
    |||||| ||| | ||||||| ||| ||||||||| | | ||  || || |||||||||||||||| |||||||||||||||| |||||||||||||    
16510946 tttttatgatatgggttgtggttctgcttcaaaccggcatcgctgcccgtgttttgttgttggatgtcgtcttcctctagatttatgtttgtgttg 16510851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 9223377 - 9223424
Alignment:
229 tgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgc 276  Q
    |||||||||||||||||||||||||||||  || | ||||||||||||    
9223377 tgttttgttgttggatttcgtcttcctctgaatttgtgtttgtgttgc 9223424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 180 - 275
Target Start/End: Complemental strand, 34866715 - 34866620
Alignment:
180 tttttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttg 275  Q
    |||||| || || ||||||| ||| ||||||||| | ||||  || || |||||||||||||||||||||||||||||| || |||||||||||||    
34866715 tttttatgacctgggttgtggttccgcttcaaaccggcgtcgctgcccgtgttttgttgttggatttcgtcttcctctaaatttatgtttgtgttg 34866620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 232 - 277
Target Start/End: Original strand, 10551783 - 10551828
Alignment:
232 tttgttgttggatttcgtcttcctctagatctatgtttgtgttgct 277  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||    
10551783 tttgttgttgggtttcgtcttcctctagatctatgtttgtgttgct 10551828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 187 - 275
Target Start/End: Complemental strand, 34389664 - 34389576
Alignment:
187 gatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttg 275  Q
    ||||| ||||||| ||| ||||||||| | ||||  || || ||||||||||| | |||||||| |||||||||| |||||||||||||    
34389664 gatctgggttgtgcttccgcttcaaaccggcgtcgctgcccgtgttttgttgtggaatttcgtcctcctctagatttatgtttgtgttg 34389576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 277
Target Start/End: Original strand, 9519093 - 9519141
Alignment:
229 tgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgct 277  Q
    |||||||||||||| ||||||||| |||||||| | ||||||| |||||    
9519093 tgttttgttgttgggtttcgtctttctctagatttgtgtttgtattgct 9519141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 180 - 275
Target Start/End: Original strand, 30963866 - 30963961
Alignment:
180 tttttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttg 275  Q
    |||||| ||||| ||||||| |||  |||||||| | ||||  || || |||||||| |||||||||||||||||||||||| |||||||||||||    
30963866 tttttatgatctgggttgtggttccacttcaaaccggcgtcgatgcccgtgttttgtggttggatttcgtcttcctctagatttatgtttgtgttg 30963961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 282
Target Start/End: Original strand, 37792734 - 37792836
Alignment:
180 tttttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgctct 279  Q
    |||||||||| | ||||||||||| ||||||||| | |||| |||||| ||||||| |||||| |||| |||| |||| ||||  ||||||||||||| |    
37792734 tttttacgatatgggttgtgtttccgcttcaaaccggcgtcgttgtccgtgttttgctgttgggtttcatctttctcttgatccgtgtttgtgttgctgt 37792833  T
280 ctg 282  Q
    |||    
37792834 ctg 37792836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 38305712 - 38305758
Alignment:
229 tgttttgttgttggatttcgtcttcctctagatctatgtttgtgttg 275  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||    
38305712 tgttttgttgttggatttcgtcttcctctagattgatgtttgtgttg 38305758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 229 - 277
Target Start/End: Complemental strand, 47326479 - 47326431
Alignment:
229 tgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgct 277  Q
    ||||||||||||||||||| |||||||||||||| || |||||||||||    
47326479 tgttttgttgttggatttcctcttcctctagatcaatatttgtgttgct 47326431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 257
Target Start/End: Original strand, 38484991 - 38485055
Alignment:
193 ggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctct 257  Q
    ||||||||||| ||||||||| | ||||  || ||||||||||||||  | ||||||||||||||    
38484991 ggttgtgtttccgcttcaaaccggcgtcgctgcccatgttttgttgtcaggtttcgtcttcctct 38485055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 187 - 275
Target Start/End: Original strand, 41919892 - 41919980
Alignment:
187 gatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcctctagatctatgtttgtgttg 275  Q
    ||||| ||||||| ||| |||||||||   |||| ||| || ||||||||||| ||||||| ||||||||||||| |||||||||||||    
41919892 gatctgggttgtggttccgcttcaaaccagcgtcgttgcccgtgttttgttgtgggatttcatcttcctctagatttatgtttgtgttg 41919980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 4651256 - 4651309
Alignment:
229 tgttttgttgttggatttcgtcttcctctagatctatgtttgtgttgctctctg 282  Q
    |||||||||||| | |||||||||||||  ||||||||||||||||||| ||||    
4651256 tgttttgttgttaggtttcgtcttcctcatgatctatgtttgtgttgctgtctg 4651309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 231 - 261
Target Start/End: Original strand, 17032909 - 17032939
Alignment:
231 ttttgttgttggatttcgtcttcctctagat 261  Q
    |||||||||||||||||||||||||||||||    
17032909 ttttgttgttggatttcgtcttcctctagat 17032939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 255
Target Start/End: Original strand, 19597943 - 19598016
Alignment:
182 tttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcct 255  Q
    ||||||||||||||||||||||  ||||| || | |||| ||| || |||| ||||||||| |||| |||||||    
19597943 tttacgatctaggttgtgtttccacttcagaccggcgtcgttgcccgtgttctgttgttgggtttcatcttcct 19598016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 255
Target Start/End: Original strand, 27712405 - 27712478
Alignment:
182 tttacgatctaggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcct 255  Q
    |||||||||||| |||||||||  ||||| || | |||| ||| || |||||||||||||| |||| |||||||    
27712405 tttacgatctagattgtgtttctacttcagaccggcgtcgttgcccgtgttttgttgttgggtttcatcttcct 27712478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 255
Target Start/End: Complemental strand, 39184893 - 39184829
Alignment:
191 taggttgtgtttcagcttcaaactgacgtcattgtccatgttttgttgttggatttcgtcttcct 255  Q
    ||||||||| ||| ||||||||||| |||| ||| | ||||||||| ||||  ||||||||||||    
39184893 taggttgtgattctgcttcaaactggcgtcgttgcctatgttttgtagttgtgtttcgtcttcct 39184829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University