View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7729_low_6 (Length: 427)
Name: NF7729_low_6
Description: NF7729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7729_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 33273133 - 33272836
Alignment:
| Q |
1 |
aagattgggagatgtggttgatccaactagtgtttcgagggatggtcgtcgacaattagcgaagagtgtaccttctgctaagggttataaataaaggttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33273133 |
aagattgggagatgtggttgatccaactagtgtttcgagggatggtcgtcgacaattagctaagagtgtaccttctgctaagggttataaataaaggttc |
33273034 |
T |
 |
| Q |
101 |
acaatcgcaatctagatcacaatataacaatttttatgttgccaaaattgtaaaacaatgtgattgaagttgcatccaccgtatttcactttgattttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33273033 |
acaatcgcaatctagatcacaatataacaatttttatgttgccaaaattgtaaaacaatgtgattgaagttgcatccaccgtatttcactttgattttca |
33272934 |
T |
 |
| Q |
201 |
catatcaaagattataaggggatcgcaaccattaatatgcccggtatttaaaatccttgatcttttttctaagctagttttatttggttaggcatata |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272933 |
catatcaaagattataaggggatcgcaaccattaatatgcccggtatttaaaatccttgatcttttttctaagctagttttatttggttaggcatata |
33272836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 370 - 411
Target Start/End: Complemental strand, 33272772 - 33272731
Alignment:
| Q |
370 |
aaggggattgcttatactttattgttagttattgtagaatat |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272772 |
aaggggattgcttatactttattgttagttattgtagaatat |
33272731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University