View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7730_high_8 (Length: 319)
Name: NF7730_high_8
Description: NF7730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7730_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 33306111 - 33305844
Alignment:
| Q |
11 |
gatgaagaggtttggtgagaatatctgccacttgttcatttgaggagataggcagtaggtgaagaattcctgattgaaatttatctctcactacatggca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33306111 |
gatgaagaggtttggtgagaatatctgccacttgttcatttgaggagataggcagtaggtgaagaattcctgattgaaatttatctctcaccacatggca |
33306012 |
T |
 |
| Q |
111 |
gtctatttctatgtgatttgta--ctcatgaaaactggattagctgctatgtgcatagctgatttattgtcacagt-----atgattggtgaagaatgag |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33306011 |
gtctatttctatgtgatttgtactctcatgaaaactggattagctgctatgtgcatagctgatttattgtcacagtagatgatgattggtgaagaatgag |
33305912 |
T |
 |
| Q |
204 |
atatttgaaaatcctgcaataagtatggcagcaattacccttcacaggttgcttgaggaagggctttg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33305911 |
atatttgaaaatcctgcaataagtatggcagcaattgcccttcacaggttgcttgaggaagggctttg |
33305844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University