View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7730_low_16 (Length: 242)
Name: NF7730_low_16
Description: NF7730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7730_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 55694985 - 55695201
Alignment:
| Q |
9 |
tgcaggttgaaacacagcaagtagcaacaaccgtgacagaaaatgaaacagttgagttaaccaaggtcgaggaaacaacacc---gggctctgaggttcc |
105 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
55694985 |
tgcaggttgaaacacagcaagcaccaacaactgtgacagaaaaggaaacagttgaggtaaccaaggtcgaggaaacaacaccaccggcctccgaggttcc |
55695084 |
T |
 |
| Q |
106 |
cacttcagaaccggccaccaccgaagaagtagtagcagtggagaaaggagaaactgaagttccagttgaagctgagagtacacaagtaactgaggaagcc |
205 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
55695085 |
tgcttcagaaccagccaccaccgaagaagtagtagcagtggagaatgaagaaactgaagttcccgttgaagctgagagtacacaagtaacccaggaagcc |
55695184 |
T |
 |
| Q |
206 |
aagccagaggtagagaa |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
55695185 |
aagccagaggtagagaa |
55695201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University