View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7730_low_19 (Length: 222)
Name: NF7730_low_19
Description: NF7730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7730_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 9864063 - 9864254
Alignment:
| Q |
14 |
aagaaacaagataatctagacaaagaaataaaagaaagagaggttgattttggattgtcaatatggcagaagaaccctctcaatgtcgtgaaaagttgac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9864063 |
aagaaacaagataatctagacaaagaaataaaagaaagagaggttgattttggattgtcaatatggcagaagaaccctctcaatgtcgtgaaaagttgac |
9864162 |
T |
|
| Q |
114 |
taatcttactgttgaagtaggaaaaaacttttttctatttatggttatggtgattatgtgcaatggtttgcattttctgacaaagccttatt |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9864163 |
taatctcactgttgaagtaggaaaaaacttttttctatttatggttatggtgattatgtgcaatggtttgcattttctgacaaagccttatt |
9864254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University