View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7731_high_3 (Length: 369)
Name: NF7731_high_3
Description: NF7731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7731_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 66 - 269
Target Start/End: Original strand, 9478383 - 9478587
Alignment:
| Q |
66 |
agttgttgctgcaaaaaacttcatgaaaattatcaattttctcgatctcatttgaatttttatgaatggaatttaatagaggagcaatatcacgatatta |
165 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| ||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9478383 |
agttgttgctgcaaaaaacttaatgaatattatcagtttcctcaatctcatttgaatttttgaaaatggaatttaatagaggagcaatatcacgatatta |
9478482 |
T |
|
| Q |
166 |
tactccatca-taacaacctcctcaccagttcaagtggtattgttaacttcctttggtgcaacaaaagaactcttctatgacatatcagcaacaaatatc |
264 |
Q |
| |
|
|||||||||| |||||| |||||| |||| |||||||||||| | ||| |||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
9478483 |
tactccatcactaacaatctcctctccagctcaagtggtattatcaacctcctttggtgcaacaaaataactcttctatgacatatgagcaacaaatatc |
9478582 |
T |
|
| Q |
265 |
aataa |
269 |
Q |
| |
|
||||| |
|
|
| T |
9478583 |
aataa |
9478587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University